snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD87
sequence
ACAATGATGACTTAAATTACTTTTTGCCGTTTACCCAGCTGAGGTTGTCTTTGAAGAAA
TAATTTTAAGACTGAGA
  Box motif
  Complementary to target RNA
length 76
organism Homo_sapiens
snoRNA name SNORD87
alias HBII-276
chromosome ⁄ contig 8
locus ⁄ host gene Mono:295:AC011031.12
organization Mono
target RNA 28S rRNA
modification type C/D
modification site 28S:G3723
accession no NR_002598,NT_008183
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved