snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD114-1
sequence
TGGACCTATGATGATGACTGGTGGCGTATGAGTCATTGACGGTGAATACAGGTCTGGAA
GTCTGAGGTCCA
  Box motif
  Complementary to target RNA
length 71
organism Homo_sapiens
snoRNA name SNORD114-1
alias 14q(II-1)
chromosome ⁄ contig 14
locus ⁄ host gene SNORD113@,SNORD114@
organization Poly
target RNA Unknown
modification type C/D
modification site
accession no NR_003193,NT_026437
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved