snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD32B
sequence
GGATTGGTGATGAGCAACAATCACCATCTTTCGTTTGAGTCTCATGGCCATGAGACCAA
CCCCATGCACTGCTCTGAGACCT
  Box motif
  Complementary to target RNA
length 82
organism Homo_sapiens
snoRNA name SNORD32B
alias U32B
chromosome ⁄ contig 6
locus ⁄ host gene Mono:83:AL645936.5
organization Mono
target RNA 18S rRNA, 28S rRNA
modification type C/D
modification site 18S:G1328,28S:A1511
accession no
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved