snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD74
sequence
CTGCCTCTGATGAAGCCTGTGTTGGTAGGGACATCTGAGAGTAATGATGAATGCCAACC
GCTCTGATGGTGG
  Box motif
  Complementary to target RNA
length 72
organism Homo_sapiens
snoRNA name SNORD74
alias U74
chromosome ⁄ contig 1
locus ⁄ host gene GAS5
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:C3820
accession no AF141346,NT_004487
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved