snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD44
sequence
CCTGGATGATGATAAGCAAATGCTGACTGAACATGAAGGTCTTAATTAGCTCTAACTGA
CTAA
  Box motif
  Complementary to target RNA
length 63
organism Homo_sapiens
snoRNA name SNORD44
alias U44
chromosome ⁄ contig 1
locus ⁄ host gene GAS5
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:A166
accession no NR_002750,NT_004487
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved