snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD80
sequence
GATACAATGATGATAACATAGTTCAGCAGACTAACGCTGATGAGCAATATTAAGTCTTT
CGCTCCTATCTGATGTATC
  Box motif
  Complementary to target RNA
length 78
organism Homo_sapiens
snoRNA name SNORD80
alias U80
chromosome ⁄ contig 1
locus ⁄ host gene GAS5
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A1521,28S:G1612
accession no AF141346,NT_004487
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved