snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD81
sequence
CAGAATACATGATGATCTCAATCCAACTTGAACTCTCTCACTGATTACTTGATGACAAT
AAAATATCTGATATTCTG
  Box motif
  Complementary to target RNA
length 77
organism Homo_sapiens
snoRNA name SNORD81
alias U81
chromosome ⁄ contig 1
locus ⁄ host gene GAS5
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A391
accession no AF141346,NT_004487
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved