snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD27
sequence
ACTCCATGATGAACACAAAATGACAAGCATATGGCTGAACTTTCAAGTGATGTCATCTT
ACTACTGAGAAGT
  Box motif
  Complementary to target RNA
length 72
organism Homo_sapiens
snoRNA name SNORD27
alias U27
chromosome ⁄ contig 11
locus ⁄ host gene SNHG1
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:A27
accession no NR_002563,NT_167190
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved