snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD30
sequence
GTTTGTGATGACTTACATGGAATCTCGTTCGGCTGATGACTTGCTGTTGAGACTCTGAA
ATCTGATTTTC
  Box motif
  Complementary to target RNA
length 70
organism Homo_sapiens
snoRNA name SNORD30
alias U30
chromosome ⁄ contig 11
locus ⁄ host gene SNHG1
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A3804
accession no NR_002561,NT_167190
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved