snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD31
sequence
CTCACCAGTGATGAGTTGAATACCGCCCCAGTCTGATCAATGTGTGACTGAAAGGTATT
TTCTGAGCTGTG
  Box motif
  Complementary to target RNA
length 71
organism Homo_sapiens
snoRNA name SNORD31
alias U31
chromosome ⁄ contig 11
locus ⁄ host gene SNHG1
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G4166
accession no NR_002560,NT_167190
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved