snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD104
sequence
GCTGTGATGACATTCCAATTAAAGCACGTGTTAGACTGCTGACGCGGGTGATGCGAACT
GGAGTCTGAGC
  Box motif
  Complementary to target RNA
length 70
organism Homo_sapiens
snoRNA name SNORD104
alias U104
chromosome ⁄ contig 17
locus ⁄ host gene Poly:10:AC025362.12
organization Poly
target RNA 28S rRNA
modification type C/D
modification site 28S:C1327
accession no AY349605,NT_010783
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved