snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD1A
sequence
CACAAGCCTATGATGGTTAGTTATCCCTGTCTGAAAATCTGGACTGAGGGAAATAATCT
ATTCTGAGGCTTA
  Box motif
  Complementary to target RNA
length 72
organism Homo_sapiens
snoRNA name SNORD1A
alias snR38A
chromosome ⁄ contig 17
locus ⁄ host gene BC042949
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G4362
accession no NR_004395,NT_010783
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved