snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD1B
sequence
CTGAGTCCATGATGATTTCAAGTTATCCCTGTCTGAAGGCAAAGAAAGGCCTTTCTGTG
TGGAATTTGAATATCTGAAACTCAG
  Box motif
  Complementary to target RNA
length 84
organism Homo_sapiens
snoRNA name SNORD1B
alias snR38B
chromosome ⁄ contig 17
locus ⁄ host gene BC042949
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G4362
accession no
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved