|
|
| Homo_sapiens SNORD114-18 | |
| sequence |
TAGATCAGTGATGACTACTGTTGGTGTATGAGTCATATACGATGAATACATGTCTGAAA
TTCTGAGGTCCAA
Box motif
Complementary to target RNA |
| length | 72 |
| organism | Homo_sapiens |
| snoRNA name | SNORD114-18 |
| alias | 14q(II-18) |
| chromosome ⁄ contig | 14 |
| locus ⁄ host gene | SNORD113@,SNORD114@ |
| organization | Poly |
| target RNA | Unknown |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |