|
|
| Gorilla_gorilla SNORD27 | |
| sequence |
ACTCCATGATGAACACAAAATGACAAGCATATGGCTGAACTTTCAAGTGATGTCATCTT
ACTACTGAGAAGT
Box motif
Complementary to target RNA |
| length | 72 |
| organism | Gorilla_gorilla |
| snoRNA name | SNORD27 |
| alias | |
| chromosome ⁄ contig | 11 |
| locus ⁄ host gene | LOC101131283 |
| organization | Intronic |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | NC_044613.1 |
| orthologs | list |
| multiple alignment | |