|
|
| Gorilla_gorilla U13 | |
| sequence |
ATTCTTTTTTAGTTCAAAAGTGTGATGATTAGGTTTTCACATTTGTGTGAGATGTGCCT
TCCTCAAACCTTGTTACAACGTCTGCACATTACCCATCGGACA
Box motif
Complementary to target RNA |
| length | 102 |
| organism | Gorilla_gorilla |
| snoRNA name | U13 |
| alias | |
| chromosome ⁄ contig | 8 |
| locus ⁄ host gene | CSMD3 |
| organization | Intronic |
| target RNA | |
| modification type | unknown |
| modification site | |
| accession no | NC_044610.1 |
| orthologs | list |
| multiple alignment | |