|
|
| Gorilla_gorilla SNORD77 | |
| sequence |
GTACTATGATAGTTGCATAGTTCAGCAGATTGAATCATCAAGAGATTTAATATTTGTCT
GATGTATCT
Box motif
Complementary to target RNA |
| length | 68 |
| organism | Gorilla_gorilla |
| snoRNA name | SNORD77 |
| alias | |
| chromosome ⁄ contig | X |
| locus ⁄ host gene | Mono:206:SNORD77 |
| organization | mono |
| target RNA | |
| modification type | unknown |
| modification site | |
| accession no | NC_044625.1 |
| orthologs | list |
| multiple alignment | |