|
|
| Gorilla_gorilla SNORD103_SNORD85 | |
| sequence |
TCTGGCAATGATGACCCACTTGCCCTCACTGAGAACAAAGTTCGGTAATGAGAATCTTT
GTTAATGGACTCAAGTTCTGAGCCAGA
Box motif
Complementary to target RNA |
| length | 86 |
| organism | Gorilla_gorilla |
| snoRNA name | SNORD103_SNORD85 |
| alias | |
| chromosome ⁄ contig | 1 |
| locus ⁄ host gene | PUM1 |
| organization | Intronic |
| target RNA | 18S rRNA |
| modification type | C/D |
| modification site | 18S:G601 |
| accession no | NC_044602.1 |
| orthologs | list |
| multiple alignment | |