|
|
| Gorilla_gorilla SNORD115 | |
| sequence |
GGGTCGATGATGAGAACCTTATATTGTTCTGAAGAGAGGTGATGACTTAAAAATCATGC
TCAATAGGATTACGCTGAGGCCC
Box motif
Complementary to target RNA |
| length | 82 |
| organism | Gorilla_gorilla |
| snoRNA name | SNORD115 |
| alias | |
| chromosome ⁄ contig | 15 |
| locus ⁄ host gene | Poly:3:SNORD115 |
| organization | poly |
| target RNA | |
| modification type | unknown |
| modification site | |
| accession no | NC_044617.1 |
| orthologs | list |
| multiple alignment | |