|
|
| Gasterosteus_aculeatus snoZ195 | |
| sequence |
TCTGTCGTTGATGATACATTTACAGCTTTGCTTGAGTTTAACGACCATGAGAAAACTCT
CATGCACTACCATCTGAGACAGA
Box motif
Complementary to target RNA |
| length | 82 |
| organism | Gasterosteus_aculeatus |
| snoRNA name | snoZ195 |
| alias | |
| chromosome ⁄ contig | groupXV |
| locus ⁄ host gene | RPL13A |
| organization | Intronic |
| target RNA | |
| modification type | unknown |
| modification site | |
| accession no | |
| orthologs | |
| multiple alignment | |