|
|
| Gasterosteus_aculeatus snoMBII-202 | |
| sequence |
TGATAAAACTCCGGAATCTCTGTATTTTCTTGATGAATACTTTGAACCCTTATATCTGA
TGACTGCTGTTTATTACTC
Box motif
Complementary to target RNA |
| length | 78 |
| organism | Gasterosteus_aculeatus |
| snoRNA name | snoMBII-202 |
| alias | |
| chromosome ⁄ contig | groupII |
| locus ⁄ host gene | RPL13 |
| organization | Intronic |
| target RNA | |
| modification type | unknown |
| modification site | |
| accession no | |
| orthologs | |
| multiple alignment | |