|
|
| Gallus_gallus SNORD19 | |
| sequence |
CATGGATGAAACAAGGCAATAAGAGTAGGATTGAAACCCTGGACTTCAGTAGATCCAAC
TCTGATTTCTTCAGATAC
Box motif
Complementary to target RNA |
| length | 77 |
| organism | Gallus_gallus |
| snoRNA name | SNORD19 |
| alias | |
| chromosome ⁄ contig | 2 |
| locus ⁄ host gene | Mono:5:SNORD19 |
| organization | Mono |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |