|
|
| Felis_catus SNORD41 | |
| sequence |
TGGGAAGTGATGATACTCCCGACCCTTGACGTCACGCTGATCTCTCGCGTATTCGTACT
GGCTGATCCCG
Box motif
Complementary to target RNA |
| length | 70 |
| organism | Felis_catus |
| snoRNA name | SNORD41 |
| alias | |
| chromosome ⁄ contig | GeneScaffold_824 |
| locus ⁄ host gene | TNPO2 |
| organization | Intronic |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |