|
|
| Erinaceus_europaeus SNORD42 | |
| sequence |
GTGCAAATGATAGAAAAATTTTAATCTGAGACTGGTGATGTCTTCAAAGGAACCACTGA
TGCAC
Box motif
Complementary to target RNA |
| length | 64 |
| organism | Erinaceus_europaeus |
| snoRNA name | SNORD42 |
| alias | |
| chromosome ⁄ contig | GeneScaffold_8836 |
| locus ⁄ host gene | RPL23A |
| organization | Intronic |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |