snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:MeU2-C28
sequence
GCGCCTTAATGCATTGAGTGATTACCTTGCACTTTGATCGCTGAGGCAG
  Box motif
  Complementary to target RNA
length 49
organism Drosophila_melanogaster
snoRNA name snoRNA:MeU2-C28
alias
chromosome ⁄ contig X
locus ⁄ host gene CG1518
organization Intronic
target RNA U2 snRNA
modification type C/D
modification site U2:C28
accession no NR_002470,AE014298
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved