|
|
| Dasypus_novemcinctus SNORD101 | |
| sequence |
GTTTGTATGATGACTTATGTGTCGGATACCCCTTCACTCTTTCAATGAGTGAAACATTG
AAGTCTGACAAAC
Box motif
Complementary to target RNA |
| length | 72 |
| organism | Dasypus_novemcinctus |
| snoRNA name | SNORD101 |
| alias | |
| chromosome ⁄ contig | GeneScaffold_2004 |
| locus ⁄ host gene | ENSDNOG00000006214 |
| organization | Intronic |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |