snOPY snoRNA Orthological Gene Database
Danio_rerio SNORD37
sequence
ATTGATGATGATTTAAACATTCTTCACTTTGACCTGAATATCTATATTACATAGAGA
  Box motif
  Complementary to target RNA
length 57
organism Danio_rerio
snoRNA name SNORD37
alias g
chromosome ⁄ contig 22.0
locus ⁄ host gene eef2a.2
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site
accession no NC_007133.6
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved