|
|
| Danio_rerio SNORD63 | |
| sequence |
CATTCTGATCAACACATCATTCTGAAGGATTTTAAATGTTTAGAATTAGTGTTTGA
Box motif
Complementary to target RNA |
| length | 56 |
| organism | Danio_rerio |
| snoRNA name | SNORD63 |
| alias | |
| chromosome ⁄ contig | 5.0 |
| locus ⁄ host gene | Mono:26:SNORD63 |
| organization | Mono |
| target RNA | 28S rRNA |
| modification type | C/D |
| modification site | |
| accession no | NC_007116.6 |
| orthologs | list |
| multiple alignment | |