|
|
| Danio_rerio SNORD47 | |
| sequence |
AACCTGTGACGACATGATTCTGCCAAATGAATCTAATGATTATACCCCAACCGTTCCAT
ATTTCTGAGGTT
Box motif
Complementary to target RNA |
| length | 71 |
| organism | Danio_rerio |
| snoRNA name | SNORD47 |
| alias | |
| chromosome ⁄ contig | 8.0 |
| locus ⁄ host gene | gas5 |
| organization | Intronic |
| target RNA | 28S rRNA |
| modification type | C/D |
| modification site | |
| accession no | NC_007119.6 |
| orthologs | list |
| multiple alignment | |