|
|
| Cavia_porcellus SNORD19 | |
| sequence |
GAAATATGATGAGTATATGAGAAGTTGAGTTAAAATGAAAAATAAAAAGATCCAACTCT
GATTTCATCCAGAGA
Box motif
Complementary to target RNA |
| length | 74 |
| organism | Cavia_porcellus |
| snoRNA name | SNORD19 |
| alias | |
| chromosome ⁄ contig | GeneScaffold_5275 |
| locus ⁄ host gene | GNL3 |
| organization | Intronic |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |