|
|
| Canis_familiaris SNORD92 | |
| sequence |
TGGTGCTGTGATGATGCCTTAAAATTGTGGTTTCGACTCACTGAGAGTAAAATGAGGAC
CTACAATTCCTTGGCTGTGTCTGAGCACC
Box motif
Complementary to target RNA |
| length | 88 |
| organism | Canis_familiaris |
| snoRNA name | SNORD92 |
| alias | |
| chromosome ⁄ contig | 17 |
| locus ⁄ host gene | WDR43 |
| organization | Intronic |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |