snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans C08D8.3
sequence
CACTTGTTACATCCAATGATGAGAGTTTGCGACTAGGGCGGTCTTACACAATCATGGTG
ATTCTAGTCATTCTGATGGTA
  Box motif
  Complementary to target RNA
length 80
organism Caenorhabditis_elegans
snoRNA name C08D8.3
alias CeN27
chromosome ⁄ contig V
locus ⁄ host gene C08D8.1
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:C980
accession no AM050289,NR_003465
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved