snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Y39G10AR.24
sequence
AAGCGATGACGATTGATATCTGCTCTAATGAGTCTGAATTACCATGTTGAGATCTTGTC
TGAGCT
  Box motif
  Complementary to target RNA
length 65
organism Caenorhabditis_elegans
snoRNA name Y39G10AR.24
alias CeN65
chromosome ⁄ contig I
locus ⁄ host gene Mono:1:Y39G10AR.24
organization Mono
target RNA 18S rRNA
modification type C/D
modification site 18S:A90
accession no AM050148,NR_003394
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved