|
|
| Arabidopsis_thaliana R72c | |
| sequence |
TTGCAAATGATGAGTTAAATCACCATTGATAAAAGAAGCTCAATTGAGCACTGTTGAAA
ATCAAAAATTTCCATGACTCTGATGCAA
Box motif
Complementary to target RNA |
| length | 87 |
| organism | Arabidopsis_thaliana |
| snoRNA name | R72c |
| alias | |
| chromosome ⁄ contig | 3 |
| locus ⁄ host gene | Mono:R72c |
| organization | Mono |
| target RNA | 25S rRNA |
| modification type | C/D |
| modification site | 25S:A1248,25S:A2712 |
| accession no | AJ429610,NC_003074 |
| orthologs | list |
| multiple alignment | |