|
|
| Arabidopsis_thaliana SnoR72-3 | |
| sequence |
GAAACTCATATAGGTCTTGCTTTGATACAGTTTGCTTTGATTTGATAAGCTAACTGTTA
CATTAACCTTGTTGAAAT
Box motif
Complementary to target RNA |
| length | 77 |
| organism | Arabidopsis_thaliana |
| snoRNA name | SnoR72-3 |
| alias | |
| chromosome ⁄ contig | 5 |
| locus ⁄ host gene | Mono:SnoR72-3 |
| organization | Mono |
| target RNA | 18S rRNA |
| modification type | H/ACA |
| modification site | 18S:U1003,18S:U1121 |
| accession no | NC_003076 |
| orthologs | list |
| multiple alignment | |