snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR96
sequence
TCAATATCTCTTCAGTAATATTGAAATCGATTTTTTACCTTGGCATACAATT
  Box motif
  Complementary to target RNA
length 52
organism Arabidopsis_thaliana
snoRNA name SnoR96
alias
chromosome ⁄ contig 25291043..25290992
locus ⁄ host gene mono:SnoR96
organization Poly
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U1246
accession no AJ505673,NC_003076
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved