snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR87
sequence
cgagctgaaatgtgctctcacttttgtggctgctaactgtacacagt
  Box motif
  Complementary to target RNA
length 47
organism Arabidopsis_thaliana
snoRNA name SnoR87
alias
chromosome ⁄ contig 3
locus ⁄ host gene EIF3G1 (eukaryotic translation initiation factor 3G1)
organization Intronic
target RNA 25S rRNA, 18S rRNA
modification type H/ACA
modification site 18S:U715,25S:U2126
accession no AJ505660,NC_003074
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved