snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR77Y-3
sequence
ACCGATGATGATTTTTGCTAATCTGTGTG
  Box motif
  Complementary to target RNA
length 29
organism Arabidopsis_thaliana
snoRNA name SnoR77Y-3
alias
chromosome ⁄ contig 4
locus ⁄ host gene poly:U49-3
organization Poly
target RNA 18S rRNA
modification type C/D
modification site 18S:U580
accession no NC_003075
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved