snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR65
sequence
ACATGATTGAGATTTTTTAATCTCGTGATTACCTTTCAAGCACTTCTGAGCCA
  Box motif
  Complementary to target RNA
length 53
organism Arabidopsis_thaliana
snoRNA name SnoR65
alias
chromosome ⁄ contig 1
locus ⁄ host gene Mono:SnoR65
organization Mono
target RNA 25S rRNA
modification type C/D
modification site 25S:G398
accession no AJ505627,NC_003070
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved