|
|
| Arabidopsis_thaliana SnoR37-2 | |
| sequence |
ggatgtggaaggggttgaatatggtgatgatacaagagtattgtggactagagtttcag
atctgggattcttctcccagaagttgaagattaacccttggctgtctgagtattaattcc cctttcacc
Box motif
Complementary to target RNA |
| length | 128 |
| organism | Arabidopsis_thaliana |
| snoRNA name | SnoR37-2 |
| alias | |
| chromosome ⁄ contig | 4 |
| locus ⁄ host gene | poly:SnoR37-2 |
| organization | Poly |
| target RNA | 25S rRNA |
| modification type | C/D |
| modification site | 25S:C2355,25S:U2411 |
| accession no | AF317936,AF317937,AJ505638,NC_003075 |
| orthologs | list |
| multiple alignment | |