|
|
| Arabidopsis_thaliana SnoR19-1 | |
| sequence |
aacagtgatgagtcagtttacagacctgtaatgattgcggtaatgatcgcattattatg
aacatctaagggactgagt
Box motif
Complementary to target RNA |
| length | 78 |
| organism | Arabidopsis_thaliana |
| snoRNA name | SnoR19-1 |
| alias | |
| chromosome ⁄ contig | 5 |
| locus ⁄ host gene | poly:SnoR88-1 |
| organization | Poly |
| target RNA | 18S rRNA |
| modification type | C/D |
| modification site | 18S:G1431,18S:U1445 |
| accession no | AJ276573,AJ240066,NC_003076,CP002688 |
| orthologs | list |
| multiple alignment | |