|
|
| Aegilops_tauschii snoZ119 | |
| sequence |
TTTTGCCGAGGAGATGATGAATATCAGAGGCTGTTTCTGAGGATGAGCCCAGAGCTCTA
CCTATGTTGCAAAATTACTGATTTGCCTATCTGATCCAAAT
Box motif
Complementary to target RNA |
| length | 100 |
| organism | Aegilops_tauschii |
| snoRNA name | snoZ119 |
| alias | |
| chromosome ⁄ contig | 3D |
| locus ⁄ host gene | LOC109771713 |
| organization | Intronic |
| target RNA | 28S rRNA |
| modification type | C/D |
| modification site | 28S:A1867 |
| accession no | NWVB02000003.1 |
| orthologs | list |
| multiple alignment | |