|
|
| Aegilops_tauschii SNOR75 | |
| sequence |
TCTCTGTGATGATGAAAACAGATGACGAGTCCGATGCAATCCATTCTATAAACCATGTG
GACAATCGAGGCATTTGTCTGAGAGAA
Box motif
Complementary to target RNA |
| length | 86 |
| organism | Aegilops_tauschii |
| snoRNA name | SNOR75 |
| alias | |
| chromosome ⁄ contig | 5D |
| locus ⁄ host gene | LOC109763810 |
| organization | Intronic |
| target RNA | 28S rRNA |
| modification type | C/D |
| modification site | 28S:A2278 |
| accession no | NWVB02000005.1 |
| orthologs | list |
| multiple alignment | |