|
|
| Aegilops_tauschii SNORD36 | |
| sequence |
GTCAAATGGTGCTAAAACAAGATATTCCTGAGATTTTCTTTGAGGAATACAAAATCAAG
CTTTTTAAAACTGATGGTT
Box motif
Complementary to target RNA |
| length | 78 |
| organism | Aegilops_tauschii |
| snoRNA name | SNORD36 |
| alias | |
| chromosome ⁄ contig | 5D |
| locus ⁄ host gene | LOC120964291 |
| organization | Intronic |
| target RNA | |
| modification type | |
| modification site | |
| accession no | NWVB02000005.1 |
| orthologs | list |
| multiple alignment | |