|
|
| Aegilops_tauschii snoZ101 | |
| sequence |
CAAATGCAGACGAGGCACCACGAGTTTATGGGTAATTTGCATCTGAGGCATTTCTTTGC
CATGACTCTTTTTCACCTTGGATCCGATGCATGCC
Box motif
Complementary to target RNA |
| length | 94 |
| organism | Aegilops_tauschii |
| snoRNA name | snoZ101 |
| alias | |
| chromosome ⁄ contig | 4D |
| locus ⁄ host gene | Mono31:snoZ101 |
| organization | Mono |
| target RNA | |
| modification type | |
| modification site | |
| accession no | NWVB02000004.1 |
| orthologs | list |
| multiple alignment | |