|
|
| Aegilops_tauschii snoR77Y | |
| sequence |
AAGCCCATGATGATTAGCTTTTTGTTGGAATTACCATCAGATTCTGAATGACGATATTT
TTGCGGCTTTCTGAGGCTTAAT
Box motif
Complementary to target RNA |
| length | 81 |
| organism | Aegilops_tauschii |
| snoRNA name | snoR77Y |
| alias | |
| chromosome ⁄ contig | 1D |
| locus ⁄ host gene | LOC109746116 |
| organization | Intronic |
| target RNA | 18S rRNA |
| modification type | C/D |
| modification site | 18S:U573 |
| accession no | NWVB02000001.1 |
| orthologs | list |
| multiple alignment | |