|
|
| Aegilops_tauschii snoZ195/SNORD33/SNORD32 | |
| sequence |
GGGAGAAGTGATGATATCATAACCATACCACATTTCTGCATTCACTGTGATGATCAATT
TATATCATGCACTACCATCTGATCTCCC
Box motif
Complementary to target RNA |
| length | 87 |
| organism | Aegilops_tauschii |
| snoRNA name | snoZ195/SNORD33/SNORD32 |
| alias | |
| chromosome ⁄ contig | 1D |
| locus ⁄ host gene | Poly22:SNOR75 |
| organization | Poly |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | NWVB02000001.1 |
| orthologs | list |
| multiple alignment | |