|
|
| Aegilops_tauschii SNORD25 | |
| sequence |
ggcaacagtgacgagttcttacagacctataatgattcttgcggaaatgattgcacagt
tcaaagaacatctaagggactgagttgtt
Box motif
Complementary to target RNA |
| length | 88 |
| organism | Aegilops_tauschii |
| snoRNA name | SNORD25 |
| alias | |
| chromosome ⁄ contig | 2D |
| locus ⁄ host gene | LOC109752124 |
| organization | Intronic |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | NWVB01000002.1 |
| orthologs | list |
| multiple alignment | |